Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ku_c4507_8157580

[Submit comment/correction]

Sequence	wsnp_Ku_c4507_8157580
Contig	2BS_5161530
Probe	wsnp_Ku_c4507_8157580
DNA Homology	2BS_5161530 Best IWGSC match 191 0 URGI_Best IWGSC_N
BLAST, e-value	0 2BS_5161530 Best IWGSC match
DNA	atcagatggaagctctggagacctgggaacagcacgctcggcgcgcgtat gagctgtttgacaaggagggcaaccggcctatcgtgatcgaagaacttgc Rtcggaactcggcctcggcccgtcggtgcccctccacgtcgtcctccagg actggatcaggcacgccgacgggaagctcagcttcctcgggttcataaag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.