Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2BS_5244392

[Submit comment/correction]

Sequence	Jagger_c9472_305
Contig	2BS_5244392
Probe	Jagger_c9472_305
DNA Homology	2BS_5244392 Best IWGSC match 132 7e-29 URGI_Best IWGSC_N
BLAST, e-value	7e-29 2BS_5244392 Best IWGSC match
DNA	cacgcgggaggccagccggccccRtcgagacccgccacgagaacacgcaa tcattcatgcggccgctgcaccgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.