Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2DS_5371129

[Submit comment/correction]

Sequence	BS00030090_51
Contig	2DS_5371129
Probe	BS00030090_51
DNA Homology	2DS_5371129 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 2DS_5371129 Best IWGSC match
DNA	tgccggtgtattcactagacggtgtttccgacaggacgaacccaaagccc Racccgcaacctaaccctaggacaaacccagcaaagccggacccagaagt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.