Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c106537_63

[Submit comment/correction]

Sequence	Excalibur_rep_c106537_63
Contig	2BL_8080499
Probe	Excalibur_rep_c106537_63
DNA Homology	2BL_8080499 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 2BL_8080499 Best IWGSC match
DNA	gacgataacccctatgttatacctgagatggatccaacactgaggaagca Ratccaggagtgtaactggcaggtcgtgaatgtgacgactcctgcaaact a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.