Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2BL_8074189

[Submit comment/correction]

Sequence	IAAV211
Contig	2BL_8074189
Probe	IAAV211
DNA Homology	2BL_8074189 Best IWGSC match 368 0 URGI_Best IWGSC_N
BLAST, e-value	0 2BL_8074189 Best IWGSC match
DNA	gaacaagagcagacacaacacaacaaacacgaagaggaagaaccagatct ggtgcagggacctctccacctccatctgctgcctcctcagccggggaccc Rccgtgtggtccgcaacggcgtaggggcttgtgtagtacatgctcggcgg cacctggccgcggaacgcccacggaagcaccgcctccgccatccctccaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.