Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c1933_407

[Submit comment/correction]

Sequence	BobWhite_c1933_407
Contig	2DL_9776017
Probe	BobWhite_c1933_407
DNA Homology	2DL_9776017 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 2DL_9776017 Best IWGSC match
DNA	ggccttggtacactttggacgccttgctcgtcaggcttaccatcttgccc Rtcgtcattcagcaatgtatctaaagttttgctgatctgaggagcaaaga c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.