Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2DL_9900253

[Submit comment/correction]

Sequence	RFL_Contig2519_341
Contig	2DL_9900253
Probe	RFL_Contig2519_341
DNA Homology	2DL_9900253 Best IWGSC match 115 1e-23 URGI_Best IWGSC_N
BLAST, e-value	1e-23 2DL_9900253 Best IWGSC match
DNA	cacccccttgcccttgatgaggaagaaggtgggcatggccttcaccccca Rcttggaagacacgcccgggacatcatcgacgtcgacgaagaggaagagc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.