Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2BL_7949726

[Submit comment/correction]

Sequence	IAAV3474
Contig	2BL_7949726
Probe	IAAV3474
DNA Homology	2BL_7949726 Best IWGSC match 263 0 URGI_Best IWGSC_N
BLAST, e-value	0 2BL_7949726 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnncatgccctttaccctcatgaaggagaggcttgagttcctggac Rcagacaagtgtgagtgcaagtcgaccctcgtcgagggcggcggcatcga cacggcgatcgagactgcgacgtcgcacatcaaggtggagccggcggcca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.