Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX5941

[Submit comment/correction]

Sequence	IACX5941
Contig	2DL_9908867
Probe	IACX5941
DNA Homology	2DL_9908867 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 2DL_9908867 Best IWGSC match
DNA	attatttctgggcaaaagcaaacgccacctccgtccaccacaccctcacc gRtctaaaaacataaccatgacaaatcctcggcctaagtgaacacatgcc tagatctagatagacaatgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.