Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_s66737_344

[Submit comment/correction]

Sequence	BobWhite_s66737_344
Contig	2DL_9864356
Chromosome	2D
Probe	BobWhite_s66737_344
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
DNA Homology	2DL_9864356 Best IWGSC match 119 9e-25 URGI_Best IWGSC_N
BLAST, e-value	9e-25 2DL_9864356 Best IWGSC match
DNA	gggtccgagaacacgacctgctccgtgagcctgcacatctccacgttctc Rcagtagcgagcaacttgcttcttgtgctcggtggtggagttgtagagga g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.