Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2DL_9910400

[Submit comment/correction]

Sequence	wsnp_RFL_Contig4402_5154408
Contig	2DL_9910400
Probe	wsnp_RFL_Contig4402_5154408
DNA Homology	2DL_9910400 Best IWGSC match 148 8e-34 URGI_Best IWGSC_N
BLAST, e-value	8e-34 2DL_9910400 Best IWGSC match
DNA	aagagctcgagtacataagcaaacttgatccRatgagggatgctgcaatg ctgcggggagaactgcccatgatacgggaggc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.