Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c37540_583

[Submit comment/correction]

Sequence	RAC875_c37540_583
Contig	2DL_9829039
Probe	RAC875_c37540_583
DNA Homology	2DL_9829039 Best IWGSC match 130 4e-28 URGI_Best IWGSC_N
BLAST, e-value	4e-28 2DL_9829039 Best IWGSC match
DNA	aacacgaggacggtgaaagacgtccaagccggcgccagccttgcggactc Rggcgtcagcagtcctgtcgggaggagcttgccgaccgtcgaagaacagc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.