Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0030f06_593

[Submit comment/correction]

Sequence	tplb0030f06_593
Contig	2DL_9909215
Probe	tplb0030f06_593
DNA Homology	2DL_9909215 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 2DL_9909215 Best IWGSC match
DNA	tgctctgataaagcacaggttgaatatatggatggcaggcttgtgcagca Mgaacaatacactcagcaaggcccgcttgattcatgcccagatcaattgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.