Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c928_311

[Submit comment/correction]

Sequence	BobWhite_c928_311
Contig	2BL_8087161
Probe	BobWhite_c928_311
DNA Homology	2BL_8087161 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 2BL_8087161 Best IWGSC match
DNA	caggatcgacatccccacggcgtggcagatgcctcagggtgggatagacc Maggggaagagccgcgagcagctgccattagggaactgagggaagaaacc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.