Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-0676_715

[Submit comment/correction]

Sequence	GENE-0676_715
Contig	2DL_9910097
Probe	GENE-0676_715
DNA Homology	2DL_9910097 Best IWGSC match 150 3e-34 URGI_Best IWGSC_N
BLAST, e-value	3e-34 2DL_9910097 Best IWGSC match
DNA	tgagccaagtcatgaagataccgatcagcaggtagactctgaaacagatt Rttgtaaatyaaatcagcttaactgcaaacattytatyt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.