Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2BS_5211606

[Submit comment/correction]

Sequence	RAC875_c14947_750
Contig	2BS_5211606
Probe	RAC875_c14947_750
DNA Homology	2BS_5211606 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 2BS_5211606 Best IWGSC match
DNA	cgcaacggggtttcattggaggacgccgtcaagcacttcagcgggtcgaa Rcgggaatccgtcgtcgagatgctggagagcctccggtgcagcttcgcgg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.