Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX1444

[Submit comment/correction]

Sequence	IACX1444
Contig	2BS_5179254
Probe	IACX1444
DNA Homology	2BS_5179254 Best IWGSC match 163 5e-38 URGI_Best IWGSC_N
BLAST, e-value	5e-38 2BS_5179254 Best IWGSC match
DNA	gtggtgggagctcgtcaagaccaccgcctggttccgcgaccactggttcc gccagcaccaRctctacgaggacctcgccgacaacgtggacgtggacgac gtcgccgccctcctccccga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.