Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX5670

[Submit comment/correction]

Sequence	IACX5670
Contig	2DS_5320426
Probe	IACX5670
DNA Homology	2DS_5320426 Best IWGSC match 191 0 URGI_Best IWGSC_N
BLAST, e-value	0 2DS_5320426 Best IWGSC match
DNA	taacggcctttaaggtggatatgcttgctcagcttctggaaatactgctg cttctgaacRagcttctcgcgtgggtaaaatggtgcttcttcgagcgtca tcctggctggctggggcgcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.