Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_rep_c107379_246

[Submit comment/correction]

Sequence	RAC875_rep_c107379_246
Contig	2AL_6330390
Probe	RAC875_rep_c107379_246
DNA Homology	2AL_6330390 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 2AL_6330390 Best IWGSC match
DNA	ttgcagcttgcttattccaaatctgaagaacaggcaaaggatgcagtggc Rtcaacgagatcccgagaattcagcctggacacgttggcaccgcaaaaca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.