Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_rep_c64934_62

[Submit comment/correction]

Sequence	BobWhite_rep_c64934_62
Contig	2DL_9905217
Chromosome	2D
Probe	BobWhite_rep_c64934_62
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
DNA Homology	2DL_9905217 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 2DL_9905217 Best IWGSC match
DNA	gcagggggatctggcctaggaatgtctggaattcctccgactacgcaagg Yggtggcatcgagagcttggcaaactacaacaagtatcagtttggtggct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.