Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2AL_6421780

[Submit comment/correction]

Sequence	Kukri_c44255_983
Contig	2AL_6421780
Probe	Kukri_c44255_983
DNA Homology	2AL_6421780 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 2AL_6421780 Best IWGSC match
DNA	tgaatgtcaatgatgataagctgcaagaactgaagaaggaatggggagaa Rgcccctacaaagctgtcatcaatgcgctgatggagatgaaagagtacaa c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.