Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig3172_2394

[Submit comment/correction]

Sequence	RFL_Contig3172_2394
Contig	2DL_9909803
Probe	RFL_Contig3172_2394
DNA Homology	2DL_9909803 Best IWGSC match 119 9e-25 URGI_Best IWGSC_N
BLAST, e-value	9e-25 2DL_9909803 Best IWGSC match
DNA	caagaaatggctcacatcgccaatggccgcgaccatggcaactgcgtctc Rctcctccgtgtcaatagcaccaactctaaccaaagcaacatgctgatcc t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.