Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c20646_2845

[Submit comment/correction]

Sequence	Kukri_c20646_2845
Contig	2DL_9875944
Probe	Kukri_c20646_2845
DNA Homology	2DL_9875944 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 2DL_9875944 Best IWGSC match
DNA	tggaggacgaccaaagactacaaggtgcagcggtacaagatacgctcgcc Rtactacaactatctgcttggcctgcttgtggtgtactgcatagcggagc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.