Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c3257_1155

[Submit comment/correction]

Sequence	RAC875_c3257_1155
Contig	2DL_9826644
Probe	RAC875_c3257_1155
DNA Homology	2DL_9826644 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 2DL_9826644 Best IWGSC match
DNA	ctcaatgccatgcacctttgcccagctgcaccaaaaccggcagcaataag Rgcattcaatgtggcatctcgatcggcatcaggaaggataatggcatgat t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.