Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_rep_c112625_307

[Submit comment/correction]

Sequence	RAC875_rep_c112625_307
Contig	2DL_9849597
Probe	RAC875_rep_c112625_307
DNA Homology	2DL_9849597 Best IWGSC match 121 2e-25 URGI_Best IWGSC_N
BLAST, e-value	2e-25 2DL_9849597 Best IWGSC match
DNA	aagaaaaggatggtgattggtggtatgcaaatgttactctacctgaaagc Rcattggtgttggactgggtttttgctgatggatcacctgggaatgcaaa c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.