Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c9345_15516120

[Submit comment/correction]

Sequence	wsnp_Ex_c9345_15516120
Contig	2DL_9826644
Probe	wsnp_Ex_c9345_15516120
DNA Homology	2DL_9826644 Best IWGSC match 171 6e-40 URGI_Best IWGSC_N
BLAST, e-value	6e-40 2DL_9826644 Best IWGSC match
DNA	acaagtatggcaatggggcttccatctttaccacatctggtgtctcggca aggaaatttcagacggacattgaagctggccaggtgggtatcaacgtgcc Ratcccagtacccctgccattcttctccttcacgggcagcaaagcttcct tcgcaggagacttgaatttctacggcaaggcgggcgtgcagttcttcacc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.