Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c22273_227

[Submit comment/correction]

Sequence	BobWhite_c22273_227
Contig	2AL_5133291
Probe	BobWhite_c22273_227
DNA Homology	2AL_5133291 Best IWGSC match 90 7e-16 URGI_Best IWGSC_N
BLAST, e-value	7e-16 2AL_5133291 Best IWGSC match
DNA	ggtggatgaaggcggcgcgcggtggagctggtcttgatggtctctctggc Ragctaggtgggtcgggccagggagtggaagccgttcttctggagccagc t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.