Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ex_c10574_1027

[Submit comment/correction]

Sequence	Ex_c10574_1027
Contig	2DL_9909746
Probe	Ex_c10574_1027
DNA Homology	2DL_9909746 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 2DL_9909746 Best IWGSC match
DNA	atacttattatcagagagtcccaagccatcattggaccatccagcagctg Rtgagatcaccatagtttgtacaaacttgggatctttgtcccattatgct a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.