Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1743_224

[Submit comment/correction]

Sequence	GENE-1743_224
Contig	3DS_2543631
Probe	GENE-1743_224
DNA Homology	3DS_2543631 Best IWGSC match 115 8e-24 URGI_Best IWGSC_N
BLAST, e-value	8e-24 3DS_2543631 Best IWGSC match
DNA	ycyyaaggacctgaaygyycataaacMtcagattctgctggtctgatgcg ctaaacgtactaccagagaaagcaaga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.