Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c9992_862

[Submit comment/correction]

Sequence	BobWhite_c9992_862
Contig	3DS_1170226
Probe	BobWhite_c9992_862
DNA Homology	3DS_1170226 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 3DS_1170226 Best IWGSC match
DNA	tccagcaacaacatcccaaagctatagacgtcagacttggacgatatggc Rccaaagctacgggacaccatctcgggagctatgtagccaactgtccccc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.