Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c4094_7399975

[Submit comment/correction]

Sequence	wsnp_Ex_c4094_7399975
Contig	3AS_2553991
Probe	wsnp_Ex_c4094_7399975
DNA Homology	3AS_2553991 Best IWGSC match 279 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AS_2553991 Best IWGSC match
DNA	ggcatggctcgactctgcgcagctgctgctgcgtcttcttcctcttgcct ttcaacagccttcctttttggaggtctacgaactgatccattttggttgc Rgggacctgagatatcagttgtggcacggccaggaactggagcagacggt ttgccaacatcatgtcctgttggcagtgtgctttgcagtagaacgctaag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.