Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1300_770

[Submit comment/correction]

Sequence	GENE-1300_770
Contig	3AS_3442274
Probe	GENE-1300_770
DNA Homology	3AS_3442274 Best IWGSC match 137 2e-30 URGI_Best IWGSC_N
BLAST, e-value	2e-30 3AS_3442274 Best IWGSC match
DNA	ttattggttgttgcatcgcaggatgtcaaatgttgcttctcagatgagac Rttgccggacgggcacaccgtgaggagagac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.