Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c66845_466

[Submit comment/correction]

Sequence	RAC875_c66845_466
Contig	3AS_3328015
Probe	RAC875_c66845_466
DNA Homology	3AS_3328015 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 3AS_3328015 Best IWGSC match
DNA	cgagccgtcgggatgcagtgcctttgagctgcagtgggagccgctccgct Rccaagctacaacatgagccgcccacgaagatggcgcccaagctgccctc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.