Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3DL_6951782

[Submit comment/correction]

Sequence	RFL_Contig4814_556
Contig	3DL_6951782
Probe	RFL_Contig4814_556
DNA Homology	3DL_6951782 Best IWGSC match 145 1e-32 URGI_Best IWGSC_N
BLAST, e-value	1e-32 3DL_6951782 Best IWGSC match
DNA	caggaggccaccacctcggagatcatcaacagcatctccaaggacgcctc Rctcatccaggaggtgctcagtgagaaggttcctctgtttctgatgcact c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.