Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3AL_4308037

[Submit comment/correction]

Sequence	Tdurum_contig58326_467
Contig	3AL_4308037
Probe	Tdurum_contig58326_467
DNA Homology	3AL_4308037 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3AL_4308037 Best IWGSC match
DNA	ggggaggagagcgtgttcctgaccatcacggacgccatcgcgtcgtgccg Rtacgggctgcagaggttcagaggcaaggagggaggcagcgaagtatagc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.