Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c15269_23491104

[Submit comment/correction]

Sequence	wsnp_Ex_c15269_23491104
Contig	3AL_4238455
Probe	wsnp_Ex_c15269_23491104
DNA Homology	3AL_4238455 Best IWGSC match 363 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AL_4238455 Best IWGSC match
DNA	ccacgcgcttcatcaaatgcaaaaaagagaaaaccccattatactgcttg cttgctgtagtatcctatcatcatcactccacctgctcgccgatgaggtc Ragcccgacgaccaagaacgacaccccctggaacagaaggaagtagaaat gtatgccctgaaccgagagcaggctgcgagctgctgctgtcaagaggagg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.