Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1820_661

[Submit comment/correction]

Sequence	GENE-1820_661
Contig	3AL_4351080
Probe	GENE-1820_661
DNA Homology	3AL_4351080 Best IWGSC match 139 5e-31 URGI_Best IWGSC_N
BLAST, e-value	5e-31 3AL_4351080 Best IWGSC match
DNA	agcgtcttcgagcaaactatgaagaaRcaaagcaacttcttctacaggtg attcgctaacacctctacgcattcatt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.