Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c8674_595

[Submit comment/correction]

Sequence	BobWhite_c8674_595
Contig	3AL_4447586
Probe	BobWhite_c8674_595
DNA Homology	3AL_4447586 Best IWGSC match 143 5e-32 URGI_Best IWGSC_N
BLAST, e-value	5e-32 3AL_4447586 Best IWGSC match
DNA	tatccaggggttcttctaccaactaaaatggatgccagtatatcatcatc Rttaggaatagcatcagtggttctttgaccatctggtgtgctggacaaat t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.