Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ex_c35861_1382

[Submit comment/correction]

Sequence	Ex_c35861_1382
Contig	3AL_4447586
Probe	Ex_c35861_1382
DNA Homology	3AL_4447586 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 3AL_4447586 Best IWGSC match
DNA	cagggaaccgcaaggacaagtagacatgtctgaaactatccgagcagata Rcagcaatgctggcatctctggtgcagaggaaagtgcagctcatgatcac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.