Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX17944

[Submit comment/correction]

Sequence	IACX17944
Contig	3AL_1371073
Probe	IACX17944
DNA Homology	3AL_1371073 Best IWGSC match 351 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AL_1371073 Best IWGSC match
DNA	ggtggcgttactggagaccacccctgcgtcacactggacgatggacttca agctttccaagcccagtccatgaagggctcgatcggctttcggagattac Rccaggcatcggtctgcgtcgagttttgcagggccgatgaatcccccgtc ccaaagatgggagcaggggccggtctcgagtatctacacccaaccaggaa t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.