Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10478148

[Submit comment/correction]

Sequence	BS00030855_51
Contig	3B_10478148
Probe	BS00030855_51
DNA Homology	3B_10478148 Best IWGSC match 90 7e-16 URGI_Best IWGSC_N
BLAST, e-value	7e-16 3B_10478148 Best IWGSC match
DNA	tggcgcagaacgcgtcgtaccagcaagggcgcgccgccggtgtcgtccag Ragcagcacgggggctacggcggcgtgcaaaatgcgtacccgcagcaagg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.