Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10420663

[Submit comment/correction]

Sequence	BS00023337_51
Contig	3B_10420663
Probe	BS00023337_51
DNA Homology	3B_10420663 Best IWGSC match 119 9e-25 URGI_Best IWGSC_N
BLAST, e-value	9e-25 3B_10420663 Best IWGSC match
DNA	cgtcttctgcgccaccgactgcaccacccaggggctctgattcccgatca Rtccatcgaccaatccatccggctagcgatgtatcaacgcatacgcaccg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.