Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ra_c27517_37034553

[Submit comment/correction]

Sequence	wsnp_Ra_c27517_37034553
Contig	3AL_4363885
Probe	wsnp_Ra_c27517_37034553
DNA Homology	3AL_4363885 Best IWGSC match 368 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AL_4363885 Best IWGSC match
DNA	atctcaaacaacttgaagataactcagataactctagcattgcaatatca cggcgtaagaaggacaaggagagaatccaagatttgctggacaaattgaa Maatgaatctgacaagcatcaccagcacgttatatcagtgctccaaagac taacccgtgaaaaggataaatggcttagttccagtccggacgcactgaag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.