Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BE604885A_Ta_2_2

[Submit comment/correction]

Sequence	wsnp_BE604885A_Ta_2_2
Contig	3DL_6920401
Probe	wsnp_BE604885A_Ta_2_2
DNA Homology	3DL_6920401 Best IWGSC match 161 2e-37 URGI_Best IWGSC_N
BLAST, e-value	2e-37 3DL_6920401 Best IWGSC match
DNA	GTACTTTTTGACATATGTTCCATAAATATGATGTAAAAATACTCTTGCAT AATCAGTGGCRGAGACAGGGTGCCAGCAGGGGCCCTGCCCCCCCCCCCCC CCAAACATCCTTGAATTCAAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.