Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig5153_2667

[Submit comment/correction]

Sequence	RFL_Contig5153_2667
Contig	3DL_6864037
Probe	RFL_Contig5153_2667
DNA Homology	3DL_6864037 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 3DL_6864037 Best IWGSC match
DNA	gagaaatgcgtgctgatgagcgtcgagatgaggcccgacttctggatcag Rttcggggacccctcccactcaggctgcctgacggagtgggcgttcacga c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.