Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX2728

[Submit comment/correction]

Sequence	IACX2728
Contig	3AL_2138262
Probe	IACX2728
DNA Homology	3AL_2138262 Best IWGSC match 152 2e-34 URGI_Best IWGSC_N
BLAST, e-value	2e-34 3AL_2138262 Best IWGSC match
DNA	tcgatctcaccaacatagtactcatccatcatcgcccgggcggtcgtgct gtgccccacRtcctcaaagtcgtcggtcgcgtccttgnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnn

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.