Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c65573_410

[Submit comment/correction]

Sequence	RAC875_c65573_410
Contig	3AL_4452228
Probe	RAC875_c65573_410
DNA Homology	3AL_4452228 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 3AL_4452228 Best IWGSC match
DNA	gagcggcaaggtcttggacagtggccctaatgatcacatttttgtgtttt Rcagtgaccatgggggtcctggggtcattgggatgcccaccaatccatac g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.