Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA003763-0481

[Submit comment/correction]

Sequence	TA003763-0481
Contig	4DL_5604422
Probe	TA003763-0481
DNA Homology	4DL_5604422 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 4DL_5604422 Best IWGSC match
DNA	gaatctgagccaacttcattcgcttcttcactatcaagatcaacatcatg Rggc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.