Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig5508_1283

[Submit comment/correction]

Sequence	RFL_Contig5508_1283
Contig	3AS_3374422
Probe	RFL_Contig5508_1283
DNA Homology	3AS_3374422 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3AS_3374422 Best IWGSC match
DNA	atggacaagctggcaggacctgctgaaaccggatgctggttattttgatc Rttgtcggtagcaggcagattggctagagcatcagtatttgtatcagaat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.