Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1579_18

[Submit comment/correction]

Sequence	GENE-1579_18
Contig	3DS_2604124
Probe	GENE-1579_18
DNA Homology	3DS_2604124 Best IWGSC match 122 4e-26 URGI_Best IWGSC_N
BLAST, e-value	4e-26 3DS_2604124 Best IWGSC match
DNA	tgtggaaactcaggtggaaggtagaaatcaaagaagaacagaccatcttg Rtatggtgtgccacttgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.